Terimakasihanda telah membaca Not Angka Lagu Bis Sekolah - Koes Plus silahkan digunakan dengan baik, jika memang perlu silahkan disebarluaskan. karena menurut saya apa yang di posting di blog atau lebih luasnya di upload di internet, itu berarti sesuatu yang memang boleh di bagikan secara luas kepada orang lain. Isi dari posting not angka yang ada di blog ini Tetapikita berdua, ditambah Muhammad Umar Hidayat, asal Demangan, seolah membuat kubu sebagai penikmat lagu-lagu barat “berkualitas tinggi”. Kita pun sering menertawakan kelompok lain yang saat itu baru getol menyenandungkan lagu-lagunya Koes Plus, Panbers atau lagu Baratnya penyanyi seperti Victor Wood sampai Eddie Peregrina. kaliini saya mencoba membahas tentang fenomena lagu Bujangan karya dari grup Legendaris Koes Plus. ada bagian dari lirik lagu mereka yg terdapat dalam lagu Bujangan yg "hati bahagia walaupun tak punya uang" yg jadi viral atau mainan dari media sosial yg banyak bertanya bagaimana hati jadi LirikLagu Koes Plus - Bujangan Artis : Koes Plus Judul Lagu : Bujangan Diciptakan Oleh : Murry Album : Vol. 10 Profil Koes Plus - Biodata Koes Plus siapa yang tidak kenal dengan grup musik legenda asal Tanah Air ini, grup musik ini sangat terkenal dengan lagu lagunya dan menjadi sebuah grup musik paling populer pada masanya, dan kini lagu lagu Pourtélécharger le mp3 de Download Lagu Kenangan Koes Plus Full Album, il suffit de suivre Download Lagu Kenangan Koes Plus Full Album mp3 If youre interested in downloading MP3 files for free, there are several factors to take into consideration. It is important to ensure that the app youre using is freeand it is compatible with the platform youre using. So, . album Simplified info_outline Major & minor chords only visibility 123 album Advanced info_outline Includes 6,7,aug,hdim7 chords visibility 123 album Bass info_outline Advance chords for bass visibility 123 album Edited info_outline All Edited versions visibility 123 album Chords Notes info_outline Notes in chords visibility 123 album Simple Notes info_outline Rhythm of the song visibility 123 album Bass Notes info_outline Sheet music of bass visibility 123 album Music Notes info_outline Sequence of instrument notes visibility 123 close aspect_ratio arrow_drop_down Show all diagrams layers Edit Lyrics cloud_done Save cancel Cancel Edit delete_forever Delete this Version 3/4Time Signature arrow_back0SHIFT arrow_forward BPM doneclose GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGCGGGFGGGGGGGCGGGFGGGGGGGCFGGGGGGCGGGGGGGCGGGFGGGCGGGFGGGCGGGGGGGCGGGGGGGFGGGGGGGCGGGGGGGFGGGGGGGCGGGGGGGCGGGGGGGCGGGFGGGCGGGFGGCGGGGGGGGCGGGGGGGFGGGGGGGCGGGGGGGFGGGGGGGCGGGGGGGCGGGGGGGCGGAFGGGCGGGFGGGCGGFGGGGCGGGGGGEmFGGGGGGGCGGGGGGGFGGGGGGGCGGGGGGGCGGGGGGGCGGGFGGGCGGGFGGGCGGGGGGGCGGGCGGGFGGGGGGGCGGGGGGGFGGGGGGGCGGGEmGGGCGGGGGGGCGGGFGGGCGGGFGGGCGGGGGGGCGGGGGGGDmGGGGGGGCGGGGGGGFGGGGGGGCGGGGGGGCGGFGGGGCGGGFGGGCGGGFGGGCGGGGGGGCGGGGGGGFGGGGGGGCGGGGGGGFGGGGGGGCGGGGGGGCGGGGGGGCGGGFGGGCGGGFGGGCGGGGGGGCGGGGGGGDmGGGGGGGCGGGGGGGFGGGGGGGCGGGGGGGDmGGGGGGGCGGGGGGGFGGGGGGGCGGGGGGGGGGGGGGGGGN Private lock Publiclanguage file_download PDF & Tabs music_note Download Midi clear ChordU Learn Any Instrument ChordU has always been about simplicity and ease of access. We are constantly improving our accuracy through research and development. We hope you have a wonderful experience with us. Hello Again !! Please login to your ChordU account. mail Login with Email Forgot Password? Don't have an account? Sign Up trending_flat clearsecurity Forgot Password No worries, enter your registered email to reset your password keyboard_backspace Back to Login Not Angka Pianika dan Lirik Lagu Bujangan – Koes Plus 444321 7,27,65… 6,6,7,15… 6,6,7,15,… 333 234 3 2 1… Begini nasib jadi bujangan Ke mana-mana asalkan suka Tiada orang yang melarang 321 6,121 5,7,231 23 321 6,121 5,7,231… Hati senang walaupun tak punya uang, oh Hati senang walaupun tak punya uang Instrumental 444 321 7,2765… 6,6,7,1 5… 6,6,7, 15,… 333 23432 1… 321 6,121 5,7,231 123 321 6,121 5,7,231… Hati senang walaupun tak punya uang, oh Hati senang walaupun tak punya uang BujanganC = Do444321 7,27,65...6,6,7,15...6,6,7,15,... 333234 3 2 1...321 6,121 5,7,23123321 6,121 5,7,231...Instrumental444 321 7,2765...6,6,7,1 5...6,6,7, 15,...333 23432 1...321 6,121 5,7,231123321 6,121 5,7,231...InstrumentalRepeat the verse and Chorus againInstrumentalEnd, means lower note 1,2, Intro C F G C F G C-F-G C G C Begini nasib jadi bujangan F C F C Ke mana-mana asalkan suka G C Tiada orang yang melarang Chorus C F G C Hati senang walaupun tak punya uang ooh.. C F G C Hati senang walaupun tak punya uang G C G C Apa susahnya hidup bujangan F C F C Setiap hari s'lalu bernyanyi G C Tak pernah hatinya bersedih Chorus C F G C Hati senang walaupun tak punya uang ooh.. C F G C G Hati senang walaupun tak punya uang Interlude C G C F C F C G C C Chorus C F G C Hati senang walaupun tak punya uang ooh.. C F G C G Hati senang walaupun tak punya uang C G C Begini nasib jadi bujangan F C F C Ke mana-mana asalkan suka G C Tiada orang yang melarang Chorus C F G C Hati senang walaupun tak punya uang ooh.. C F G C Hati senang walaupun tak punya uang G C G C Apa susahnya hidup bujangan F C F C Setiap hari s'lalu bernyanyi G C Tak pernah hatinya bersedih Chorus C F G C Hati senang walaupun tak punya uang ooh.. C F G C G Hati senang walaupun tak punya uang Interlude C G C F C F C G C C Chorus C F G C Hati senang walaupun tak punya uang ooh.. C F G C G Hati senang walaupun tak punya uang G C G C Apa susahnya hidup bujangan F C F C Setiap hari s'lalu bernyanyi G C Tak pernah hatinya bersedih Chorus C F G C Hati senang walaupun tak punya uang ooh.. C F G C Hati senang walaupun tak punya uang ooh.. C F G C Hati senang walaupun tak punya uang ooh.. C F G C Hati senang walaupun tak punya uang Outro C album Simplified info_outline Major & minor chords only visibility 123 album Advanced info_outline Includes 6,7,aug,hdim7 chords visibility 123 album Bass info_outline Advance chords for bass visibility 123 album Edited info_outline All Edited versions visibility 123 album Chords Notes info_outline Notes in chords visibility 123 album Simple Notes info_outline Rhythm of the song visibility 123 album Bass Notes info_outline Sheet music of bass visibility 123 album Music Notes info_outline Sequence of instrument notes visibility 123 close aspect_ratio arrow_drop_down Show all diagrams layers Edit Lyrics cloud_done Save cancel Cancel Edit delete_forever Delete this Version 3/4Time Signature arrow_back0SHIFT arrow_forward BPM doneclose CCCCFCCCGCCCCCCCFCCCGCCCCCFGCCCCCCCCCGCCCCCCCFCCCCCCCFCCCCCCCGCCCCCCCCCCCFCCCGCCCCCCCCCCCFCCDmCCCCCCCCGCCCCCCCGCCCCCCCFCCCCCCCFCCCCCCCGCCCCCCCCCCCFCCCCCCCCCCCCCCCFCCCCCCCCCCCGCCCCCCCGCCCCCCCFCCCCCCCFCCCCCCCGCCCCCCCCCCCFCCCCCCCCCCCCCCCFCCCCCCCCCCCGCCCCCCCGCCCCCCCFCCCCCCCFCCCCCCCGCCCCCCCCCCCFCCCCCCCCCCCCCCCFCCCCCCCCCCCCCCCFCCCCCCCCCCCCCCCFCCCEmGCCCCCCNN Private lock Publiclanguage file_download PDF & Tabs music_note Download Midi clear ChordU Learn Any Instrument ChordU has always been about simplicity and ease of access. We are constantly improving our accuracy through research and development. We hope you have a wonderful experience with us. Hello Again !! Please login to your ChordU account. mail Login with Email Forgot Password? Don't have an account? Sign Up trending_flat clearsecurity Forgot Password No worries, enter your registered email to reset your password keyboard_backspace Back to Login Intro C F G C F G C-F-G C G C begini nasib jadi bujangan.. F C F C kemana-mana.. asalkan suka.. G C tiada.. orang yang melarang.. Reff F G C hati senang walaupun tak punya uang oo.. F G C G hati senang walaupun tak punya uang.. C G C apa susahnya hidup bujangan.. F C F C setiap hari.. hanya bernyanyi.. G C tak pernah.. hatinya bersedih.. Reff F G C hati senang walaupun tak punya uang oo.. F G C G hati senang walaupun tak punya uang.. Musik C G C F C F C G C.. Reff F G C hati senang walaupun tak punya uang oo.. F G C G hati senang walaupun tak punya uang.. C G C begini nasib jadi bujangan.. F C F C kemana-mana.. asalkan suka.. G C tiada orang yang melarang.. Reff F G C hati senang walaupun tak punya uang oo.. F G C hati senang walaupun tak punya uang oo.. F G C hati senang walaupun tak punya uang oo.. F G C hati senang walaupun tak punya uang..

not angka lagu bujangan koes plus